rs11728461 chr4:40327531 A>G
- Sequence
agcagagagacagtgtttgcaacg[A/G]gcagggaaatattgcacaattgtg
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.36 | 0.97 | 1.07 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, biploar disorder (bipolar schizoaffective disorder), bipolar disorder, homa-b, infant head circumference, rheumatoid arthritis