rs117304208 chr8:72287284 C>G
- Sequence
gtttcagttccagtattaggaaga[C/G]catgccgtcttacctgcaggtctg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.33 | -0.82 | 1.21 | n/a | No Hit | |||
| STAG1_HUMAN | 0.79 | -0.54 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2