rs117306408 chr13:41133015 G>C
- Sequence
ttcctagattcgattttgtggttt[G/C]gaactgtggttttggaatccagag
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.96 | 0.34 | 2.09 | |||
| HepG2 (hepatoblastoma) | -0.83 | 1.94 | 2.00 |
Items per page:
1 – 2 of 2