rs11731100 chr4:9765556 A>T
- Sequence
gggattctatcatgggttatctgt[A/T]tggatacgcaatgtaatcacaaaa
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.84 | -0.74 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.41 | -0.84 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.26 | 1.71 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.82 | 1.68 | 1.00 |
Items per page:
1 – 4 of 4