rs11732182 chr4:100096185 C>T
- Sequence
ttagcaaacgcagacgtgctcgct[C/T]gcacagaacacgctccctctggtg
- ASB in cell types
- MM1.S (plasma cell myeloma) MCF7L-P(immortalized breast epithelial cell line) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | 2.07 | -1.75 | 1.17 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 0.50 | 1.37 | 2.00 | |||
| GBM39 (Human brain tumor) | 0.95 | -3.08 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid