rs11732433 chr4:184965204 G>A
- Sequence
ggatggagtgccgggatgagagcc[G/A]ggatggagcgccaggatggagtgc
- ASB in cell types
- 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) naive IgD+ B cells
- ASB for transcription factors
- FOXP1_HUMAN IKZF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | 2.71 | -1.91 | 2.00 | n/a | No Hit | |||
| IKZF3_HUMAN | 2.30 | -4.09 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2