rs11732941 chr4:26132231 A>G
- Sequence
ggtcaccatccatatgaaaacaca[A/G]aatttaaatattctcacagagact
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.19 | 1.04 | 1.18 | |||
| MS-1 (Small cell lung carcinoma) | 1.68 | -1.39 | 1.00 |
Items per page:
1 – 2 of 2