rs11733050 chr4:47373295 G>A
- Sequence
ttttatttgagttggggtgagaat[G/A]gtggttgaaatgacagtgtctgct
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | 1.20 | 0.29 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, chronic kidney disease, cognitive response of healthy volunteers to topiramate treatment as measure by the symbol search cognitive test, hdl cholesterol, hypertension (early onset hypertension), lp-pla2 activity, panic disorder, paternal transmission distortion, refractive error, serum creatinine, systolic blood pressure (sbp), extremes in sbp and age, waist circumference in type 2 diabetes, years of education