rs11733183 chr4:89248943 G>A
- Sequence
cagctgcctgaatgtgcacctgtg[G/A]catgatgccagggcactggctgga
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 3.18 | n/a | 2.00 | -0.20 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP barnes akathisia rating scale, hdl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins