rs11733480 chr4:69521121 G>A
- Sequence
ttagggtctcctgagagctattac[G/A]tcactcaatgaagctcttctctgc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CREB1_HUMAN ATF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 3.36 | -3.90 | 1.50 | -5.16 | Concordant | |||
| ATF7_HUMAN | 2.27 | n/a | 1.00 | -1.19 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), ldl cholesterol, parkinsons disease, years of education
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Sun_Exposed_Lower_leg