rs11733842 chr4:7965213 C>T
- Sequence
ccccaaggcctcacctgccccatg[C/T]gcacacccagcattgagcctggag
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -2.22 | 2.55 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Minor_Salivary_Gland, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood