rs11734819 chr4:40897694 C>G
- Sequence
taagtgagaggaaacaggtgtaag[C/G]gggactaggcagctccgcccgagg
- ASB in cell types
- A549 (lung carcinoma) WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.02 | 0.23 | 1.01 | |||
| WA01 (H1, human embryonic stem cells) | 1.28 | -0.45 | 1.20 |
Items per page:
1 – 2 of 2