rs11736408 chr4:21507571 T>G
- Sequence
gcaccaggccaggcaatggctttt[T/G]aattcaaagatgctatttcaactc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.65 | 0.74 | 1.46 | n/a | No Hit | |||
| STAG1_HUMAN | 2.20 | 0.96 | 1.19 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in nonasthmatic participants >=30 years old), triglycerides change with statins