rs11738110 chr5:167565755 T>G
- Sequence
tgtgctgagatcagggattgaaat[T/G]caatcactttatctattgcactat
- ASB in cell types
- GM02630 (Fanconi anemi) GM02610 (Lymphoblastoid Cell Lines) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 1.71 | -0.99 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.38 | 2.03 | 1.00 | |||
| hepatocytes | -0.95 | 1.73 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, hypertension (early onset hypertension), nicotine dependence (smoking), ever smokers versus never smokers, resistance to kuru in aged women despite likely exposure