rs117398779 chr7:99500216 C>A
- Sequence
aacaccgggccccaccacaccagg[C/A]ccctctccacactctcctttcctc
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 2.28 | -1.90 | 1.00 | -4.55 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
