rs11740470 chr5:133431173 G>A
- Sequence
ctggcactttcccactgaacccag[G/A]tgtggccttcttatttacctctca
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 2.02 | n/a | 2.00 | -5.10 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, obesity with early age of onset (age >2), stabilized warfarin dose, taste change in healthy volunteers in response to topiramate treatment (less sweet)