rs117405403 chr1:197774968 G>C
- Sequence
gggcaggctttgcggcctagcgcc[G/C]tcccgccggccggccagaggcttg
- ASB for transcription factors
- TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | n/a | 2.51 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid