rs11741252 chr5:124977259 C>T
- Sequence
ctcagcctataaaatcctgccact[C/T]atgttgctgaagcagagctctctg
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 2.69 | n/a | 2.00 | -3.30 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, bipolar disorder and schizophrenia, cystatin c in serum, parkinsons disease, rheumatoid arthritis, triglycerides