rs11741608 chr5:104413091 G>A
- Sequence
tttgcctataagtgccacctactg[G/A]cctgcactttgaacagcacaggct
- ASB in cell types
- 22RV1 (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line) HMEC (human mammary epithelial cells) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.44 | -0.69 | 1.33 | -4.52 | Concordant | |||
| STAG1_HUMAN | 2.36 | -2.38 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
