rs117422163 chr7:43440096 G>A
- Sequence
ggtgtcccaccgtggttaggagca[G/A]agtgttggggtgatggccatggaa
- ASB in cell types
- foreskin keratinocyte VCaP (prostate carcinoma) GBM39 (Human brain tumor) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.92 | n/a | 3.00 | |||
| VCaP (prostate carcinoma) | -3.03 | 1.96 | 1.50 | |||
| GBM39 (Human brain tumor) | 1.62 | n/a | 5.00 | |||
| upper lobe of left lung | 1.40 | -0.85 | 1.00 |
Items per page:
1 – 4 of 4