rs11744173 chr5:179668592 T>C
- Sequence
caccagtgccccctcacgtccaca[T/C]tctgcattgccttagtgaagagcg
- ASB in cell types
- HepG2 (hepatoblastoma) pancreas K562 (myelogenous leukemia) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.19 | 0.08 | 1.11 | |||
| pancreas | 1.23 | -0.66 | 1.11 | |||
| K562 (myelogenous leukemia) | 0.22 | 1.00 | 2.01 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.10 | -1.24 | 1.00 | |||
| adrenal gland | 1.18 | -0.54 | 1.00 |
Items per page:
1 – 5 of 19
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol change with statins, ldl cholesterol, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid