rs11744199 chr5:133191406 G>A
- Sequence
gctaactgaaaattgtagctctgg[G/A]accatctgctggctactctccaga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 2.27 | n/a | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.51 | -1.18 | 1.00 |
Items per page:
1 – 2 of 2