rs11744246 chr5:177982251 G>A
- Sequence
aggagtgcctgggacattttgcat[G/A]gcctccaaggaagcagcagccagg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -4.47 | 3.08 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.09 | -0.13 | 3.09 |
Items per page:
1 – 2 of 2