rs11744260 chr5:4295870 T>A
- Sequence
cccacggagaccgccagccggggc[T/A]gaagtggagctcctgcacccccta
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma) HT1080 (fibrosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | n/a | 1.48 | 2.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -1.18 | 1.69 | 1.17 | |||
| HT1080 (fibrosarcoma) | 2.33 | 0.09 | 2.00 |
Items per page:
1 – 3 of 3