rs117465815 chr19:14023567 A>G
- Sequence
tgagaccctgtgtcaaaaaaaaaa[A/G]aaaaagaaaagaaaaagaaaaaag
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts GM02630 (Fanconi anemi) SK-N-SH (neuroblastoma) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -1.31 | 2.36 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1