rs11746768 chr5:6559355 G>A
- Sequence
cttgataatgcaatgttccttctt[G/A]ttgccagaaagacaaaattacaag
- ASB in cell types
- LHSAR (prostate epithelial cells) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.38 | -1.07 | 1.75 | -2.14 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, college completion, diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, hip bone mineral density (bmd), infant head circumference, rheumatoid arthritis, spine bone mineral density (bmd), urinary albumin-to-creatinine ratio, years of education