rs11746936 chr5:159104541 G>C
- Sequence
tgcggggcccctgaactgcacccg[G/C]aagatggcgcgagtggccgaacac
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.74 | 0.76 | 1.40 | n/a | n/a | |||
| CTCF_HUMAN | 2.50 | 1.40 | 1.40 | 0.88 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid