rs11747247 chr5:1200458 T>G
- Sequence
aaacgggcagcgcccgacagagga[T/G]ggcctccaactccctgtgcggaaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | 0.47 | 1.15 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), irritible bowel syndrome, ldl cholesterol change with statins, parkinsons disease, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Spleen, Stomach