rs11749411 chr5:37837595 G>T
- Sequence
cagaaaccgtctgagccgtgtcgc[G/T]cccacgcggcccggaggctgtgtt
- ASB in cell types
- WA09 (embryonic stem cells) GBM39 (Human brain tumor) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.63 | -0.06 | 1.44 | |||
| GBM39 (Human brain tumor) | n/a | 0.82 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.31 | -0.32 | 1.00 |
Items per page:
1 – 3 of 3