rs11750212 chr5:37463644 G>C
- Sequence
tgtcaagagttactccgtgagaga[G/C]cattcacttcctcatgactccggt
- ASB in cell types
- THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 2.03 | -0.66 | 1.60 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, college completion, height, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood