rs117515545 chr19:53535916 C>T
- Sequence
gcctcccaggttcaagcgaatctc[C/T]tgactcagcctcctgagaaactga
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- KDM1A_HUMAN SOX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 3.71 | -4.05 | 1.00 | n/a | n/a | |||
| SOX5_HUMAN | 2.46 | -2.49 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung