rs11753320 chr6:74575029 C>T
- Sequence
ggaagccatctggtggtcttgagg[C/T]gtaactgcctgtgatgaagcctat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.18 | 1.82 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.03 | 1.00 | 1.17 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (broad definition) (males), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), salmonella-induced pyroptosis, urinary albumin-to-creatinine ratio, waist hip ratio, years of education