rs11755671 chr6:34568209 C>T
- Sequence
tgatggcctcctgatctgggagcc[C/T]acagggacagggttctttctcacg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | n/a | 3.31 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), bipolar disorder, birth weight, chronic kidney disease, height, ldl cholesterol, refractive error, rheumatoid arthritis, tetrology of fallot, total cholesterol