rs117559388 chr2:38536227 G>C
- Sequence
cgttcccaccgcgaaggcccgggc[G/C]cgcgctgctgtggatcgagtctgg
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma) epidermal keratinocytes glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC3(bone mets prostate adenocarcinoma) | -1.08 | 2.47 | 2.00 | |||
| epidermal keratinocytes | 2.34 | n/a | 2.00 | |||
| glioblastoma cells | n/a | 0.59 | 1.50 |
Items per page:
1 – 3 of 3