rs117569851 chr19:10871316 T>C
- Sequence
cgcgcccgagcaccgcccccgacg[T/C]accctcccgccccgcagttcccgg
- ASB in cell types
- erythroid cells MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.12 | n/a | 2.00 | |||
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | 0.03 | 1.60 | 2.00 | |||
| monocytes from periferal blood | 1.20 | -0.22 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid