rs11757666 chr6:119110730 C>T
- Sequence
aatttcaagcactcagatactgat[C/T]caccattcttttatatttcacaat
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.64 | -1.78 | 1.50 | |||
| K562 (myelogenous leukemia) | 0.06 | 0.77 | 1.97 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.20 | 0.87 | 1.02 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood