rs117582232 chr19:12778101 G>A
- Sequence
acccctccccggtagacgggcggg[G/A]taatgtgcactaattagaggttat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- VEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| VEZF1_HUMAN | -1.25 | 2.04 | 2.00 | -3.01 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
