rs11759141 chr6:155850714 T>G
- Sequence
cataataaatcacataactgggct[T/G]taaaaattactctccgaagtgacc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.10 | -1.02 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, fasting blood glucose, premature ovarian failure, primary rhegmatogenous retinal detachment, schizophrenia, tetrology of fallot