rs117592032 chr7:43440089 A>G
- Sequence
ctccggaggtgtcccaccgtggtt[A/G]ggagcagagtgttggggtgatggc
- ASB in cell types
- foreskin keratinocyte VCaP (prostate carcinoma) MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.03 | n/a | 3.00 | |||
| VCaP (prostate carcinoma) | -3.34 | 2.11 | 1.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.56 | n/a | 1.00 | |||
| HEK293 (embryonic kidney) | -0.10 | 0.65 | 1.65 | |||
| upper lobe of left lung | 1.48 | -1.07 | 1.00 |
Items per page:
1 – 5 of 5