rs11759240 chr6:34154746 G>A
- Sequence
gcccggctctctgtgcccgcagaa[G/A]ggagtgccactgccccgggcaggc
- ASB in cell types
- foreskin keratinocyte erythroid cells GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.92 | n/a | 2.00 | |||
| erythroid cells | 2.94 | -5.27 | 2.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 0.75 | -0.42 | 1.00 |
Items per page:
1 – 3 of 3