rs11759705 chr6:84550043 A>G
- Sequence
ccctgcgttattaactcaaaccag[A/G]attaaactccacataatggtggcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) 2588 (Lymphoblastoid Cell Lines) MCF10AT1 (breast premetastatic epithelial cells)
- ASB for transcription factors
- RFX5_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | 3.61 | -3.95 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | 1.51 | 0.67 | 1.18 | n/a | No Hit |
Items per page:
1 – 2 of 2