rs117612011 chr11:67262895 G>A
- Sequence
ggagcctgccactccggaagtggg[G/A]aagggcagtccaggcaagggaact
- ASB in cell types
- RO01746 (CD14+ monocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RO01746 (CD14+ monocytes) | 2.54 | -2.58 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid