rs11761461 chr7:17707159 G>T
- Sequence
aaatttcgtttcaaccctggaaat[G/T]atgacaaatgatgttggttagtga
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -0.35 | 2.04 | 1.00 | |||
| foreskin keratinocyte | 1.53 | -0.43 | 2.33 |
Items per page:
1 – 2 of 2