rs11761662 chr7:128410363 A>G
- Sequence
atgccaggtcccctggagcgcctc[A/G]tacccgcagaccgcagacctcccg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.86 | 0.24 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.08 | 0.67 | 1.49 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hip bone mineral density (bmd), hypertension (early onset hypertension), maternal transmission distortion, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood