rs11762591 chr7:121545549 T>C
- Sequence
cagaaataaacattttctgcccac[T/C]taaataacagagacctcttctgat
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.16 | -5.80 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), autism, late onset alzheimers disease, maternal transmission distortion, neuroblastoma (brain cancer), parkinsons disease, rheumatoid arthritis, salmonella-induced pyroptosis, transmission distortion, triglycerides change with statins, variant creutzfeldt-jakob disease, waist hip ratio