rs11762746 chr7:11261845 G>T
- Sequence
ggttgcttggctctttcccagctt[G/T]tgggggtagggggattttatagtc
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.56 | 0.12 | 1.58 | n/a | No Hit |
Items per page:
1 – 1 of 1