rs117629202 chr17:46267230 C>A
- Sequence
tcctgcacgcgagatcccagggcg[C/A]ccgacccatgcgggccgtttcgct
- ASB in cell types
- foreskin keratinocyte BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) GM10847 (female B-cells Lymphoblastoid Cell Lines) breast tumor
- ASB for transcription factors
- CTCF_HUMAN CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.73 | 0.02 | 1.80 | 1.48 | Weak Discordant | |||
| CDK9_HUMAN | 1.92 | 0.08 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
