rs11763704 chr7:4830329 C>T
- Sequence
cagcaggtgtctctctagggccca[C/T]tcgagagtgggagcgtaggccgca
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) glioblastoma cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.03 | 0.42 | 1.96 | |||
| HepG2 (hepatoblastoma) | 0.43 | 0.81 | 1.12 | |||
| glioblastoma cells | n/a | 1.19 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.47 | 0.38 | 1.00 |
Items per page:
1 – 4 of 4