rs11766000 chr7:77989974 A>G
- Sequence
ttctggtggaagtggcagggttgt[A/G]taatggactctttgagggttctta
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia) neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.58 | 0.63 | 1.19 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.31 | -0.64 | 1.50 | |||
| neural progenitors | 2.14 | -1.58 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis