rs117668038 chr7:6484193 C>T
- Sequence
tggccagggacgtggccgaactgc[C/T]ggcgcgcgcgcgcgcggggcaccc
- ASB in cell types
- K562 (myelogenous leukemia) LNCaP (prostate carcinoma)
- ASB for transcription factors
- XBP1_HUMAN E2F1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| XBP1_HUMAN | -0.83 | 1.72 | 1.00 | n/a | No Hit | |||
| E2F1_HUMAN | 0.68 | 1.67 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Liver, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid